Development in a Blink » trigrams

10 PowerShell Posts I Did in 2009

Doug Finke — Fri, 01 Jan 2010 20:05:15 +0000

I had fun doing these PowerShell posts.

Try PowerShell – An Interactive Tutorial	Michael Foord inspired this with his Try Python Silverlight application
How to Host PowerShell in a WPF Application	A How To video
PowerShell Out-ExcelPivotTable – Quickly Create Pivot Tables in Microsoft Excel	Automating Excel Pivot tables with PowerShell
PowerShell, An Exercise in Species Barcoding	Inspired by Peter Norvig’s (Director of research at Google) python version
PowerShell – Find the K most common words in a file	Based on Jon Bentley’s approach in “Little Languages”
PowerShell ISE-Cream – Alias Expansion	Uses PowerShell’s tokenizer to expand aliases like %, ? etc. into ForEach and Where
Update: Dynamic GUIs and the PowerShell Pipeline	How to inject GUIs into a PowerShell Pipeline
PowerShell yUML Workbench	yUML is a web service. A How To using PowerShell to generate UML diagrams
PowerShell, PowerBoots and an Oslo DSL Grammar	Blending MGrammar and PowerShell
Creating and Displaying Trigrams with PowerShell	Based on Wolfram\|Alphas Trigram visuals. Combines PowerShell and yUML

PowerShell Gotcha- almost

Doug Finke — Thu, 21 May 2009 23:41:59 +0000

I posted Creating and Displaying Trigrams with PowerShell. I tried the code on a machine with an older version and it failed on the ForeEach.

$result = ForEach($i in (1..5)) { $i * 2 }

PowerShell in Win 7 RC allows statements on the right hand side of an assignment. $result contains the array 2,4,6,8.

Run on an older version and PowerShell complains.

Solutions

PowerShell sub expressions or create a function around the ForEach. I prefer adding 3 extra characters $().

$result = $(ForEach($i in (1..5)) { $i * 2 })

The trigram code is updated.

Download Here

Creating and Displaying Trigrams with PowerShell

Doug Finke — Thu, 21 May 2009 00:46:11 +0000

Trigrams are a special case of the N-gram, where N is 3. They are often used in natural language processing for doing statistical analysis of texts. WolframAlpha supports them and has a DNA example.

It looked liked something fun to implement in PowerShell and diagram with the yUML script I put together.

All you need is PowerShell, an Internet connection and the script below to try it out.

If you’re running Windows 7, you’re good to go. PowerShell is installed out of the box.

WolframAlpha Triads

trigrams "AGCAGCTGACTGATCGTAGCTGACT"

PowerShell + yUML

trigrams ‘AGCAGCTGACTGATCGTAGCTGACT’

Function trigrams ($target) {
Get-yUMLDiagram (Convert-ToyUml ( Create-Tree ( Get-Triads $target ) )) -show
}

Download the Script

I am not satisfied with Create-Tree function. It works but is not flexible.